View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_23 (Length: 389)
Name: NF0645_low_23
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 175 - 303
Target Start/End: Complemental strand, 19261230 - 19261102
Alignment:
| Q |
175 |
gggactggttctcgcaattaagaagctttgaaaatgtccggtgccatgggaataaattattcaccaatagagtgtttctcaaaacagaattgtgaaaaag |
274 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
19261230 |
gggactggttttcgcaattaagaagctttgaaaatgtccggtgccatgggaataaattattcatcgatagagtgtttctcaaaacagaattgtgaaaaag |
19261131 |
T |
|
| Q |
275 |
gatgggctggaagcttggggtatttttta |
303 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
19261130 |
gatgggctggcagcttggggtatttttta |
19261102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 333 - 381
Target Start/End: Complemental strand, 19261103 - 19261055
Alignment:
| Q |
333 |
tagcagcagaagaaagttgcagatacatgtttttctcctgtcctttgct |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19261103 |
tagcagcagaagaaagttgcagatacatgtttttctcctgtcctttgct |
19261055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 107 - 136
Target Start/End: Original strand, 33922870 - 33922899
Alignment:
| Q |
107 |
gtgcactaaagctccaacataagcagggtc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33922870 |
gtgcactaaagctccaacataagcagggtc |
33922899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3161 times since January 2019
Visitors: 4029