View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0645_low_23 (Length: 389)

Name: NF0645_low_23
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0645_low_23
NF0645_low_23
[»] chr2 (2 HSPs)
chr2 (175-303)||(19261102-19261230)
chr2 (333-381)||(19261055-19261103)
[»] chr6 (1 HSPs)
chr6 (107-136)||(33922870-33922899)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 175 - 303
Target Start/End: Complemental strand, 19261230 - 19261102
Alignment:
175 gggactggttctcgcaattaagaagctttgaaaatgtccggtgccatgggaataaattattcaccaatagagtgtttctcaaaacagaattgtgaaaaag 274  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
19261230 gggactggttttcgcaattaagaagctttgaaaatgtccggtgccatgggaataaattattcatcgatagagtgtttctcaaaacagaattgtgaaaaag 19261131  T
275 gatgggctggaagcttggggtatttttta 303  Q
    |||||||||| ||||||||||||||||||    
19261130 gatgggctggcagcttggggtatttttta 19261102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 333 - 381
Target Start/End: Complemental strand, 19261103 - 19261055
Alignment:
333 tagcagcagaagaaagttgcagatacatgtttttctcctgtcctttgct 381  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
19261103 tagcagcagaagaaagttgcagatacatgtttttctcctgtcctttgct 19261055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 107 - 136
Target Start/End: Original strand, 33922870 - 33922899
Alignment:
107 gtgcactaaagctccaacataagcagggtc 136  Q
    ||||||||||||||||||||||||||||||    
33922870 gtgcactaaagctccaacataagcagggtc 33922899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University