View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_25 (Length: 384)
Name: NF0645_low_25
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0645_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 167 - 374
Target Start/End: Complemental strand, 49766396 - 49766189
Alignment:
Q |
167 |
taacagtcctaatagcaacaacacaggttcttttgaacgtaaagtttcaagatctagatctgttggatgtggtagcagaagcttctctggtgatttcttt |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49766396 |
taacagtcctaatagcaacaacacaggttcttttgaacgtaaagtttcaagatctagatctgttggatgtggtagcagaagcttctctggtgatttcttt |
49766297 |
T |
 |
Q |
267 |
gaaagaatttcaactgggtttggagattgtactctcagaagagttgaatctcaacgtgaaggtaaatcaaagggagtagttgctaattctaatggtattg |
366 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
49766296 |
gaaagaatttcaactgggtttggagattgtactctcagaagagttgaatctcaacgtgaaggtaaatcaaagggagtagttgctagttctaatggtattg |
49766197 |
T |
 |
Q |
367 |
cttctgtg |
374 |
Q |
|
|
|||||||| |
|
|
T |
49766196 |
cttctgtg |
49766189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 202 - 328
Target Start/End: Original strand, 14138362 - 14138488
Alignment:
Q |
202 |
aacgtaaagtttcaagatctagatctgttggatgtggtagcagaagcttctctggtgatttctttgaaagaatttcaactgggtttggagattgtactct |
301 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||| | |
|
|
T |
14138362 |
aacgtaaggtttcaagatctagatctgttggatgtggtagcagaagcttctctggtgatttctttgagaaaatctcaactgggtttggagattgtacctt |
14138461 |
T |
 |
Q |
302 |
cagaagagttgaatctcaacgtgaagg |
328 |
Q |
|
|
|||||||| ||||||||||||||||| |
|
|
T |
14138462 |
aagaagagtggaatctcaacgtgaagg |
14138488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University