View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0645_low_39 (Length: 329)

Name: NF0645_low_39
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0645_low_39
NF0645_low_39
[»] chr3 (1 HSPs)
chr3 (1-168)||(21194164-21194331)
[»] chr2 (1 HSPs)
chr2 (60-168)||(8496882-8496990)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 21194331 - 21194164
Alignment:
1 ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttggatttattaaaccatctacacttgtcattggtcctgaaagtagcattggtgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
21194331 ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttggatttattaaaccatctacacttgtcattggtcctgaaagtagcattgatgc 21194232  T
101 tgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgttgtccttcat 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21194231 tgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgttgtccttcat 21194164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 168
Target Start/End: Original strand, 8496882 - 8496990
Alignment:
60 ccatctacacttgtcattggtcctgaaagtagcattggtgctgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgtt 159  Q
    |||||| |||||| ||||| |||||| |||| |||   |||||||| ||  |||||||||||||||||  | |||| ||||||||| | ||||||||||     
8496882 ccatctgcacttgacattgatcctgatagtaacatgcttgctgctgctgaagttgttgatgccattgccatagctgctggtggtagtggatggttatgtg 8496981  T
160 gtccttcat 168  Q
     ||||||||    
8496982 ttccttcat 8496990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University