View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_42 (Length: 322)
Name: NF0645_low_42
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 80 - 190
Target Start/End: Complemental strand, 37045889 - 37045776
Alignment:
| Q |
80 |
gatgaatgcggcagtcggtctctgtttaattac---aatctgcatgccatcatgcattagactcactgtaccactttcgtacctacgtgtctacctctca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37045889 |
gatgaatgcggcagtcggtctctgtttaattactacaatctgcatgccatcatgcattagactcactgtaccactttcggacctacgtgtctacctctca |
37045790 |
T |
|
| Q |
177 |
taataaattctgga |
190 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37045789 |
taataaattctgga |
37045776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 216 - 265
Target Start/End: Complemental strand, 37045788 - 37045739
Alignment:
| Q |
216 |
aataaattctggatcttttctcataataaagcagaactgcgcaaatcctc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37045788 |
aataaattctggatcttttctcataataaagcagaactgcgcaaatcctc |
37045739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3605 times since January 2019
Visitors: 4038