View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_44 (Length: 309)
Name: NF0645_low_44
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 78 - 230
Target Start/End: Original strand, 8091279 - 8091430
Alignment:
| Q |
78 |
taatcaaaaacataataaaaaggaatcatgagtggacttaacctaagtgatacaagagttaaaacttaaaacaatcaatgnnnnnnnnngaaagaggaaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8091279 |
taatcaaaaacataataaaaaggaatcatgagtggacttaacctaagtgatacaagagttaaaacttaaaacaatcaatg-aaaaaaaagaaagaggaaa |
8091377 |
T |
|
| Q |
178 |
taaacaaaaattgaggagtttaattgaagaaaggaagatggtgagtttgtttg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8091378 |
taaacaaaaattgaggagtttaattgaagaaaggaagatggtgattttgtttg |
8091430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3607 times since January 2019
Visitors: 4038