View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_51 (Length: 267)
Name: NF0645_low_51
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0645_low_51 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 51 - 267
Target Start/End: Complemental strand, 23607925 - 23607709
Alignment:
Q |
51 |
ctcactaaattttttgttgcaactaaactcacaaagaggaccctactaactaaaatcaatattannnnnnngatggaaaactaaaatcaatatttataca |
150 |
Q |
|
|
||||| || ||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
23607925 |
ctcaccaatttttttgttgcaactaaacacacaaagaggaccctattaactaaaatcaatattatttttttgatggaaaactaaaatcaatatttataca |
23607826 |
T |
 |
Q |
151 |
acatatttcaaatatttaatacaaacctttcgatacacacatactaaaacaacaatcatcaacagatccgtggaggtctacaaacaaaaaacataaattg |
250 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||| |
|
|
T |
23607825 |
acatatttcacgtattttatacaaacctttcgatacacacatactaaaacaacaatcatcaacagatccatcgaggtctacaaacaaaacacataaattg |
23607726 |
T |
 |
Q |
251 |
aaggaacactttcttaa |
267 |
Q |
|
|
||||||||||||||||| |
|
|
T |
23607725 |
aaggaacactttcttaa |
23607709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University