View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0645_low_51 (Length: 267)

Name: NF0645_low_51
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0645_low_51
NF0645_low_51
[»] chr8 (1 HSPs)
chr8 (51-267)||(23607709-23607925)


Alignment Details
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 51 - 267
Target Start/End: Complemental strand, 23607925 - 23607709
Alignment:
51 ctcactaaattttttgttgcaactaaactcacaaagaggaccctactaactaaaatcaatattannnnnnngatggaaaactaaaatcaatatttataca 150  Q
    ||||| || ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||       |||||||||||||||||||||||||||||    
23607925 ctcaccaatttttttgttgcaactaaacacacaaagaggaccctattaactaaaatcaatattatttttttgatggaaaactaaaatcaatatttataca 23607826  T
151 acatatttcaaatatttaatacaaacctttcgatacacacatactaaaacaacaatcatcaacagatccgtggaggtctacaaacaaaaaacataaattg 250  Q
    ||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||    
23607825 acatatttcacgtattttatacaaacctttcgatacacacatactaaaacaacaatcatcaacagatccatcgaggtctacaaacaaaacacataaattg 23607726  T
251 aaggaacactttcttaa 267  Q
    |||||||||||||||||    
23607725 aaggaacactttcttaa 23607709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3504 times since January 2019
Visitors: 4036