View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_52 (Length: 265)
Name: NF0645_low_52
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 255
Target Start/End: Complemental strand, 38281953 - 38281719
Alignment:
| Q |
30 |
cttggaacctctttggagcataaaatccaccaccaagatcattaacatcaattgaacaagaattatgatcat---------cttgtttagtagcactaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38281953 |
cttggaacctctttggagcataaaatccaccaccaagatcattaacatcaattgaacaagaattatgatcatattgatcatcttgtttagtagcactaga |
38281854 |
T |
 |
| Q |
121 |
attactcttttccccttcaatttccctataattattaagataaactttcaatggaccaacatagttttcaaaaccaagtgttgtcatagcccaaagaaga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38281853 |
attactcttttccccttcaatttccctataattattaagataaactttcaatggaccaacatagttttcaaaaccaagtgttgtcatagcccaaagaaga |
38281754 |
T |
 |
| Q |
221 |
tcatcaccattaattgttttccttttttctctctg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38281753 |
tcatcaccattaattgttttccttttttctctctg |
38281719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 9722855 - 9722789
Alignment:
| Q |
177 |
caacatagttttcaaaaccaagtgttgtcatagcccaaagaagatcatcaccattaattgttttcct |
243 |
Q |
| |
|
||||||| | |||||| ||||| ||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
9722855 |
caacataatcttcaaatccaagagttgtcatagcccaaagaagatcatcaccgttgattgttttcct |
9722789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University