View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_57 (Length: 251)
Name: NF0645_low_57
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 38525910 - 38526148
Alignment:
| Q |
1 |
ctttcttaagtatagctgatttaatctcttgttgtgcaacatatataaaatcggaccagatattgaagnnnnnnnnnn--tctcctgttgtgcaacctac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38525910 |
ctttcttaagtatagctgatttaatctcttgttgtgcaacata----aaatcggaccagatattgaaagaaagaaaaaaatctcctgttgtgcaacctac |
38526005 |
T |
 |
| Q |
99 |
taaaactttggtgttgtgaagaatttttcgtaatgtcattgtaacatatggaaatttaagaagaggctttgtttgggtatcattttgtagtttatataat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38526006 |
taaaactttggtgttgtgaagaatttttcgtaatgtcattgtaacatatggaaatttaagaagaggctttgttttggtatcattttgtagtttatataat |
38526105 |
T |
 |
| Q |
199 |
catgtctatggaactattcatcaagtcatcaacctcttctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38526106 |
catgtctatggaactattcatcaagtcatcaacctcttctctg |
38526148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University