View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_64 (Length: 237)
Name: NF0645_low_64
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 3790949 - 3791060
Alignment:
| Q |
1 |
ggtgcttttaattgataaaagaactttctttatatcacttctatcatcttcaggttccaaaccatctgggagtgtcaccacttgtatcttgtcttgctcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3790949 |
ggtgcttttaattgataaaagaactttctttatatcacttctatcatcttcaggttccaaaccatctggaagtgtcaccacttgtatcttgtcttgctcg |
3791048 |
T |
|
| Q |
101 |
gaaacacaggtt |
112 |
Q |
| |
|
||||||| |||| |
|
|
| T |
3791049 |
gaaacaccggtt |
3791060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 3798408 - 3798297
Alignment:
| Q |
1 |
ggtgcttttaattgataaaagaactttctttatatcacttctatcatcttcaggttccaaaccatctgggagtgtcaccacttgtatcttgtcttgctcg |
100 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3798408 |
ggtgcttttaatagataaaataactttctttatatcacttctatcatcttcagattccaaaccatctgggagtgtcatcacttgtatcttgtcttgctcg |
3798309 |
T |
|
| Q |
101 |
gaaacacaggtt |
112 |
Q |
| |
|
|||||| |||| |
|
|
| T |
3798308 |
aaaacaccggtt |
3798297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 5 - 75
Target Start/End: Original strand, 3770843 - 3770913
Alignment:
| Q |
5 |
cttttaattgataaaagaactttctttatatcacttctatcatcttcaggttccaaaccatctgggagtgt |
75 |
Q |
| |
|
||||| ||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3770843 |
cttttgattgagaagagaactttcttttgatcacttctatcatcttcaggttccaaaccatctgggagtgt |
3770913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3631 times since January 2019
Visitors: 4039