View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0645_low_72 (Length: 214)

Name: NF0645_low_72
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0645_low_72
NF0645_low_72
[»] chr6 (1 HSPs)
chr6 (1-117)||(32052270-32052386)


Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 32052270 - 32052386
Alignment:
1 aagctttcatggttgtggtggcaattggaaataataatggcaagatgtggcacctagttctatactttgggagtgaaataatgtaatgttgtcttgtcgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32052270 aagctttcatggttgtggtggcaattggaaataataatggcaagatgtggcacctagttctatactttgggagtgaaataatgtaatgttgtcttgtcgt 32052369  T
101 tttactatgttgatttt 117  Q
    |||||||||||||||||    
32052370 tttactatgttgatttt 32052386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University