View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_78 (Length: 203)
Name: NF0645_low_78
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0645_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 3807870 - 3807970
Alignment:
| Q |
1 |
gagaatgagcaagttaatcaaaatcttatgcatggcagccaaaaaatgcatgaaggataaaaagttgcatatggggccatggaggaggcataagtacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807870 |
gagaatgagcaagttaatcaaaatcttatgcatggcagccaaaaaatgcatgaaggataaaaagttgcatatggggccatggaggaggcataagtacatg |
3807969 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
3807970 |
g |
3807970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 3776178 - 3776263
Alignment:
| Q |
15 |
taatcaaaatcttatgcatggcagccaaaaaatgcatgaaggataaaaagttgcatatggggccatggaggaggcataagtacatg |
100 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
3776178 |
taatcaaaatattatgcaatgcagccaaaaaatgcatgaaggataaaaaaatgcacatggggccatggaggaagcataggtacatg |
3776263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University