View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0645_low_8 (Length: 468)
Name: NF0645_low_8
Description: NF0645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0645_low_8 |
 |  |
|
[»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 90 - 458
Target Start/End: Original strand, 68579 - 68947
Alignment:
Q |
90 |
tctttctgctacctttgcagatttacctgctcctcaatggaattgggaacaaatgccatctgctcccgtgcctcgtttagatggttacgctattcagatt |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
68579 |
tctttctgctacctttgcagatttacctgctcctcaatggaattgggaacagatgccatctgctcctgtgcctcgtttagatggttacgctattcagatt |
68678 |
T |
 |
Q |
190 |
ctaaatttgttctatgtcttttccggatatgcaaatcttgaccatgttagttggttcttatttcgtcgaatacaataacaaccgtaattgtgtgacgaaa |
289 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
T |
68679 |
ctaaatttgttttatgtcttttccggatatgccaatcttgatcatgttagttggttcttatttcgttgaatacaacaacaaccgtaattgtgtgacgaaa |
68778 |
T |
 |
Q |
290 |
gagcttaattgatgattttggtttcttacaatgcaggtgcactctcatgttgatgtgtatgatttcacgagtaataaatgggtagagaggtttgatacac |
389 |
Q |
|
|
| |||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
68779 |
gtgcttaattgatgattttggtttctaacattgcaggttcactctcatgttgatgtgtatgatttcacgagtaataaatgggtagagaggtttgatacac |
68878 |
T |
 |
Q |
390 |
caaaagaaatggctaattcacatttgggaattgcaactgatgggagaaggtacatatatatagtctctg |
458 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
68879 |
caaaagaaatggcaaattcacatttgggaattgcaactgatgggaaaaggtacatatatattgtctctg |
68947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2586 times since January 2019
Visitors: 4010