View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0646_high_9 (Length: 258)
Name: NF0646_high_9
Description: NF0646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0646_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 62 - 229
Target Start/End: Original strand, 37305910 - 37306072
Alignment:
| Q |
62 |
tcatatgtttgatattaaacaaacaattatgttaaacgaatgacataaatcaaactgagacgttcttcaacagttcaaccgatgaaaattacctttgcct |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37305910 |
tcatatgtttgatattaaacaaacaattatgttaaacgaatggcataaat-----tgagacgttcttcaacagttcaaccgatgaaaattacctttgctt |
37306004 |
T |
|
| Q |
162 |
caatggtgtatcatctattcgcgtatgtgaatggattggttgaatgagggccattttttcaatggatt |
229 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306005 |
caatggtgtatcacctattcgcgtatgtgaatggattggttgaatgagggccattttttcaatggatt |
37306072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37305846 - 37305891
Alignment:
| Q |
1 |
atatgaagttttgaaaatatgctgcagtaaaaagaagcgaacaatg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
37305846 |
atatgaagttttgaaaatatgctgcagtaaaaaaaagcgaaaaatg |
37305891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3105 times since January 2019
Visitors: 4028