View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0646_low_10 (Length: 317)
Name: NF0646_low_10
Description: NF0646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0646_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 117 - 283
Target Start/End: Original strand, 10306411 - 10306577
Alignment:
| Q |
117 |
tctcattccaccatcacttctctctctctaacctctttcgtttttctctccatggattcagtattctccaccattctcatcattctcgctattctcttca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306411 |
tctcattccaccatcacttctctctctctaacctctttcgtttttctctccatggattcagtattctccaccattctcatcattctcgctattctcttca |
10306510 |
T |
|
| Q |
217 |
tcaccttcatgctttcactcatgccccgtttccttcaaatccgcataaatcgccgacgtctcctctc |
283 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10306511 |
tcaccttcatgctttcactcatgctccgtttccttcaactccgcataaatcgccgacgtctcctctc |
10306577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3040 times since January 2019
Visitors: 4024