View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0646_low_11 (Length: 313)
Name: NF0646_low_11
Description: NF0646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0646_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 13 - 177
Target Start/End: Complemental strand, 29753392 - 29753228
Alignment:
Q |
13 |
aatataacaacccaggaactagaaagcttcgtttgaaaaaactacaaagctgggttttttaatcaattagaaacaaggatgggttttaccattgttccgt |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29753392 |
aatataacaacccaggaactagaaagcttcgtttgaaaaaactacaaagctgggttttttaatcaattagaaacaaggatgggttttaccattgttccgt |
29753293 |
T |
 |
Q |
113 |
tgagagaagatgcatctgaattttttagagagaagttaaagtgtaaccgttaaattgatctaaga |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
T |
29753292 |
tgagagaagatgcatctgaattttttagagagaagttaaagtgtaaccgttcatttgatctaaga |
29753228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 180 - 284
Target Start/End: Complemental strand, 29752954 - 29752850
Alignment:
Q |
180 |
tattatttagtcctctcatcatatctcattatacttaaccaatgtgaccacattattacctaatcgccatttttgtttgatacttataataaggatcgat |
279 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
29752954 |
tattatttagtcctctcatcatatctcattatacttaacctatgtgaccacattattacctaatcgccatttttgtttgatacttataataaagatcgat |
29752855 |
T |
 |
Q |
280 |
aatgc |
284 |
Q |
|
|
||||| |
|
|
T |
29752854 |
aatgc |
29752850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3269 times since January 2019
Visitors: 4030