View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0646_low_7 (Length: 388)
Name: NF0646_low_7
Description: NF0646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0646_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 97 - 388
Target Start/End: Original strand, 34451899 - 34452188
Alignment:
| Q |
97 |
acaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34451899 |
acaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
34451998 |
T |
|
| Q |
197 |
atatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaaacnnnnnnnnn |
296 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
34451999 |
atatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaagc--ttttttt |
34452096 |
T |
|
| Q |
297 |
nngcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatctt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34452097 |
ttgcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatctt |
34452188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2901 times since January 2019
Visitors: 4018