View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0646_low_9 (Length: 359)
Name: NF0646_low_9
Description: NF0646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0646_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 30 - 349
Target Start/End: Original strand, 37769216 - 37769540
Alignment:
Q |
30 |
ggtaaatctcgcaaagatgtgagttcaactcttgctgctggtgtgaggtcacaccctcgcagctttgagccatgaggcttggctatggtgaaccctggga |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37769216 |
ggtaaatctcgcaaagatgtgagttcaactctcgctgctggtgtgaggtcacaccctcgcagctttgagccatgaggcttggctatggtgaaccctggga |
37769315 |
T |
 |
Q |
130 |
cccaactcacctaaccttttattcgcagc-----tgcaattgcgatcgcaaccaaatcataaagatagttaaaaggggtgctcctaagaataaaaatttc |
224 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37769316 |
cccaactcacctaaccttttattcgcagcgtagctgcaattgcgatcacaaccaaatcataaagatagttaaaaggggtgctcctaagaataaaaatttc |
37769415 |
T |
 |
Q |
225 |
tttagcacaagtggaagggcacaagtttcgtgtgttgttatctattcttcccaattgggaggtagctgagattggaagaaacctgaaacatctgttcatg |
324 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
37769416 |
tttagcacaagtggaagggcacaagtttcgtgtgttgttatctattcttcccaattgggaggtagctgatattggaagaaacctgaaacatctgttcatg |
37769515 |
T |
 |
Q |
325 |
tcaaattttcctgctcttttctctg |
349 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
37769516 |
tcaaattttcctgctcttttctctg |
37769540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2890 times since January 2019
Visitors: 4018