View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_high_10 (Length: 265)
Name: NF0647_high_10
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 92 - 231
Target Start/End: Complemental strand, 1191984 - 1191846
Alignment:
| Q |
92 |
aactagactcacttgtcattgatagtttaaatttgtctaattttctctctctcnnnnnnnnnnnnnaaaaatttgaacctataaaatatgactttattat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
1191984 |
aactagactcacttgtcattgatagtttaaatttgtctaattttttctctgt-tttttttttttaaaaaaatttgaacctataaaatatgactttattat |
1191886 |
T |
 |
| Q |
192 |
atatgagttgagaggttgattcgataatgtgatgatgtcc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
1191885 |
atatgagttgagaggttgattcgataatatgctgatgtcc |
1191846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 36 - 74
Target Start/End: Complemental strand, 1192011 - 1191973
Alignment:
| Q |
36 |
ataggttgtcaacacactacgctctttaactagactcac |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1192011 |
ataggttgtcaacacactacgctctttaactagactcac |
1191973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University