View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_high_14 (Length: 247)
Name: NF0647_high_14
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0647_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 77 - 234
Target Start/End: Complemental strand, 52193802 - 52193645
Alignment:
Q |
77 |
tacagctgtgtttcgttcaaaacctcaatcgaaggttgtttgcattgatctaggtatcgatcgttcatgcaaaaatctttcgtgaattttcaattgcatg |
176 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52193802 |
tacagctgtgtttcgttcaaaacctcaatcgaaggttgtttgcattgatctaggtatcgatcgttcatgcaaaaatctttcgtgaattttcaattgcatg |
52193703 |
T |
 |
Q |
177 |
atttaggttttatttactttatctcaatatatgtgtgattttgaagatgatgatgatg |
234 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
52193702 |
atttaggttttatttactttatctcaatttatgtgtgattttgaagatgatgatgatg |
52193645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 91 - 187
Target Start/End: Original strand, 1964936 - 1965028
Alignment:
Q |
91 |
gttcaaaacctcaatcgaaggttgtttgcattgatctaggtatcgatcgttcatgcaaaaatctttcgtgaattttcaattgcatgatttaggtttt |
187 |
Q |
|
|
|||||||||||||||||| | |||||| ||||||||||||| |||||||||||||||| || || | |||||||||||||||||||||||||| |
|
|
T |
1964936 |
gttcaaaacctcaatcgaggattgtttccattgatctaggt----atcgttcatgcaaaaacctctcctacattttcaattgcatgatttaggtttt |
1965028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1119 times since January 2019
Visitors: 4112