View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_high_6 (Length: 323)
Name: NF0647_high_6
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0647_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 37432163 - 37431870
Alignment:
Q |
1 |
agaattgatcaaagaagatagattgaagaaccttgagtgctttgaggaaagtaaaaccaggtgcattgatggggatagagtacatgcctttagacaaatc |
100 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37432163 |
agaattgatcaaagaagatagagtgaagaaccttgagtgctttgtggaaagtaaaaccaggtgcattgatggggatagagtacatgcctttagacaaatc |
37432064 |
T |
 |
Q |
101 |
agtaaatgaacttccaatgtttttaacaatgttctgattagaggttcccatgaaaacatggataatggatttaaaggaaaccttcttcatctctttcaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37432063 |
agtaaatgaacttccaatgtttttaacaatgttctgattagaagttcccatgaaaacatggataatggatttaaaggaaaccttcttcatctctttcaag |
37431964 |
T |
 |
Q |
201 |
agctcgatggggtgcttcatgctagacaattcttctaacgaattgattgcaatgtcctcgagacgttctaggtacatgtctaacaccttgtgac |
294 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37431963 |
agctcgatggggtgcttcatgctagacaattcttctaacgaattgattgcaatgtcctcgagacgttctaggtacatgtctaacaccttgtgac |
37431870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 996 times since January 2019
Visitors: 4105