View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_11 (Length: 428)
Name: NF0647_low_11
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 40783061 - 40782842
Alignment:
| Q |
1 |
ttatagtgataatcagcttgcagtgtatcaggttgatcaagtgcttcttcctatggcactttttggacaaggtccaaccgctgcgcctgcggaggctcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783061 |
ttatagtgataatcagcttgcagtgtatcaggttgatcaagtgcttcttcctatggcactttttggacaaggtccaaccgctgcgcctgcggaggctcct |
40782962 |
T |
|
| Q |
101 |
gcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaaagggtcttcagatagtccggctgatgattcgagtgctgttggtttgaatggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782961 |
gcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaaagggtcttcggatagtccggctgatgattcgagtgctgttggtttgaatggct |
40782862 |
T |
|
| Q |
201 |
acatagttaatggtgctaca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40782861 |
acatagttaatggtgctaca |
40782842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 333 - 368
Target Start/End: Complemental strand, 40782729 - 40782694
Alignment:
| Q |
333 |
ccttgagccagtttgagttgattgatgatgatgatg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782729 |
ccttgagccagtttgagttgattgatgatgatgatg |
40782694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 950 times since January 2019
Visitors: 4105