View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_23 (Length: 318)
Name: NF0647_low_23
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 5347227 - 5346931
Alignment:
| Q |
1 |
tccatcaacacctccctccccttcttcattgcatgaaacaaaatggtattgttttcgattcgaattcgttcaataccctccttaattttcttatcaaatt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347227 |
tccatcaacacctccctcaccttcttcattccatgaaacaaaatggtattgttttcgattcgaattcgttcaataccctccttaattttcttatcaaatt |
5347128 |
T |
|
| Q |
101 |
tggtgtttctcataacaataatagtaaaaactttcactttgttattgatattttggattatattcaaacacaaaatcttcatcctgttggtactacacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5347127 |
tggtgtttctcataacaataatagtaaaaactttcactttgttattgatattttggattatattcaaacacaaaatcttcatcctgttgatactacacct |
5347028 |
T |
|
| Q |
201 |
tttatttataattctctgttaattgcttctataaagaataatcaaattccacttgctttgtcaatttttaataatattatgacacttggtgatgatg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347027 |
tttatttataattctctgttaattgcttctataaagaataatcaaattccacttgctttgtcaatttttaataatattatgacacttggtgatgatg |
5346931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 534 times since January 2019
Visitors: 4087