View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0647_low_29 (Length: 302)

Name: NF0647_low_29
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0647_low_29
NF0647_low_29
[»] chr4 (1 HSPs)
chr4 (1-189)||(44520827-44521015)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 44521015 - 44520827
Alignment:
1 tggagggatgagatcctcaaaaaggaattgctttacgtaaatggaatcgtggggtgccttttctgatcaatgtctctatcatacacactcttctcttttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44521015 tggagggatgagatcctcaaaaaggaattgctttacgtaaatggaatcgtggggtgccttttctgatcaatgtctctatcatacacactcttctcttttt 44520916  T
101 gttgcatggaccgtgatatgatcaatatccctataccttaactccaactacaatcaaagtaaaaggaggaaactggaaagtatcatgat 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
44520915 gttgcatggaccgtgatatgatcaatatccctataccttaactccaactacaataaaagtaaaaggaggaaactggaaagtatcatgat 44520827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University