View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_32 (Length: 286)
Name: NF0647_low_32
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 13780017 - 13779825
Alignment:
| Q |
47 |
atgagatggacatcatcatcccactttgaaccaaacaaactgttttgaatcccaaacatgacctaattaccttatttagttgctggaattacacgaggtc |
146 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13780017 |
atgagatgaaaatcaacatcccactttgaaccaaacgaactgttttgaatcccaaacatgacctaattaccttatttagttgctggaattacacgaggtc |
13779918 |
T |
|
| Q |
147 |
gggcacaaccttactacatgtctctttcgaaacaaatagtaacgatccatgcaaggcctaacagtggtaagatgcagaccatgataattccta |
239 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13779917 |
ggacacaaccttactacatgtctcttttgaaacaaatagtaacgatccatgcaaggcctaacagtggtaagatgcagaccatgataattccta |
13779825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 541 times since January 2019
Visitors: 4087