View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0647_low_32 (Length: 286)

Name: NF0647_low_32
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0647_low_32
NF0647_low_32
[»] chr3 (1 HSPs)
chr3 (47-239)||(13779825-13780017)


Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 13780017 - 13779825
Alignment:
47 atgagatggacatcatcatcccactttgaaccaaacaaactgttttgaatcccaaacatgacctaattaccttatttagttgctggaattacacgaggtc 146  Q
    |||||||| | |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13780017 atgagatgaaaatcaacatcccactttgaaccaaacgaactgttttgaatcccaaacatgacctaattaccttatttagttgctggaattacacgaggtc 13779918  T
147 gggcacaaccttactacatgtctctttcgaaacaaatagtaacgatccatgcaaggcctaacagtggtaagatgcagaccatgataattccta 239  Q
    || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13779917 ggacacaaccttactacatgtctcttttgaaacaaatagtaacgatccatgcaaggcctaacagtggtaagatgcagaccatgataattccta 13779825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 541 times since January 2019
Visitors: 4087