View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0647_low_37 (Length: 281)

Name: NF0647_low_37
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0647_low_37
NF0647_low_37
[»] chr4 (1 HSPs)
chr4 (98-258)||(23459009-23459169)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 98 - 258
Target Start/End: Complemental strand, 23459169 - 23459009
Alignment:
98 agaagcaagctagttaccttagcggcggagtaaggtgcggcgcggttaccggcgcgattaagaatacggcgagcgggtccaggtccggaagcgggtccgg 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23459169 agaagcaagctagttaccttagcggcggagtaaggtgcggcgcggttaccggcgcgattaagaatacggcgagcgggtccaggtccggaagcgggtccgg 23459070  T
198 gtctggaacggcctcctctagggttaccggatccggattttttgttgttcttgatgatgtc 258  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
23459069 gtctggaacggcctcctctagggttaccggatccggattttttgttgttcttaatgatgtc 23459009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 544 times since January 2019
Visitors: 4087