View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_37 (Length: 281)
Name: NF0647_low_37
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 98 - 258
Target Start/End: Complemental strand, 23459169 - 23459009
Alignment:
| Q |
98 |
agaagcaagctagttaccttagcggcggagtaaggtgcggcgcggttaccggcgcgattaagaatacggcgagcgggtccaggtccggaagcgggtccgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23459169 |
agaagcaagctagttaccttagcggcggagtaaggtgcggcgcggttaccggcgcgattaagaatacggcgagcgggtccaggtccggaagcgggtccgg |
23459070 |
T |
 |
| Q |
198 |
gtctggaacggcctcctctagggttaccggatccggattttttgttgttcttgatgatgtc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23459069 |
gtctggaacggcctcctctagggttaccggatccggattttttgttgttcttaatgatgtc |
23459009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University