View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_40 (Length: 270)
Name: NF0647_low_40
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0647_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 4201176 - 4200928
Alignment:
Q |
1 |
aataaaataaaaaacgaataaattagggtttagttcatattcaattttgttcaattcaattgaattcgattttcaatgatgatggaaggagcaagcaatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4201176 |
aataaaataaaaaacgaataaattagggtttagttcatattcaattttgttcaattcaattgaattcgattttcaatgatgatggaaggagcaagcaatg |
4201077 |
T |
 |
Q |
101 |
gaggaatgttgtatcacgaggtacaagaatcgaagctttgcgctgttcattgcgtcaacactgttcttcaaggtccgtttttctctgaattcgacttggc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
4201076 |
gaggaatgttgtatcacgaggtacaagaatcgaagctttgcgctgttcattgcgtcaacactgttcttcaaggtccgtttttctctgaatttgacttggc |
4200977 |
T |
 |
Q |
201 |
tgctcttgcttctgatctcgattgcaaagagaggcagatgatgatgatg |
249 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4200976 |
tgctcttgcttctgatctcgattgcaaagagaggcagatgatgatgatg |
4200928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1232 times since January 2019
Visitors: 4114