View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_41 (Length: 268)
Name: NF0647_low_41
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 34630720 - 34630508
Alignment:
| Q |
29 |
atcatcaagagataaattttcaaaatccactcggcatggttgtaagtaccactttaaaagcagtaacttgttttcttttctctcaatattctttatgtgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34630720 |
atcatcaagagataaattttcaaaatccactcggcatggttgtaagtaccacttaaaaagcagtaacttgtttccttttctctcaatattctttatgtgg |
34630621 |
T |
|
| Q |
129 |
gctaaactatatggtaagaacttggcgtggagattaaagagcatttctataattcattaaaacacggtatatagtattattaggcattccgtgaaacaac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630620 |
gctaaactatatggtaagaacttggcgtggagtttaaagagcatttctacaattcattaaaacacggtatatagtattattaggcattccgtgaaacaac |
34630521 |
T |
|
| Q |
229 |
tattgcaacagct |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34630520 |
tattgcaacagct |
34630508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 556 times since January 2019
Visitors: 4089