View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0647_low_42 (Length: 265)

Name: NF0647_low_42
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0647_low_42
NF0647_low_42
[»] chr1 (2 HSPs)
chr1 (92-231)||(1191846-1191984)
chr1 (36-74)||(1191973-1192011)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 92 - 231
Target Start/End: Complemental strand, 1191984 - 1191846
Alignment:
92 aactagactcacttgtcattgatagtttaaatttgtctaattttctctctctcnnnnnnnnnnnnnaaaaatttgaacctataaaatatgactttattat 191  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||| |              ||||||||||||||||||||||||||||||||||    
1191984 aactagactcacttgtcattgatagtttaaatttgtctaattttttctctgt-tttttttttttaaaaaaatttgaacctataaaatatgactttattat 1191886  T
192 atatgagttgagaggttgattcgataatgtgatgatgtcc 231  Q
    |||||||||||||||||||||||||||| || ||||||||    
1191885 atatgagttgagaggttgattcgataatatgctgatgtcc 1191846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 36 - 74
Target Start/End: Complemental strand, 1192011 - 1191973
Alignment:
36 ataggttgtcaacacactacgctctttaactagactcac 74  Q
    |||||||||||||||||||||||||||||||||||||||    
1192011 ataggttgtcaacacactacgctctttaactagactcac 1191973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 993 times since January 2019
Visitors: 4105