View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_45 (Length: 256)
Name: NF0647_low_45
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0647_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 4194491 - 4194429
Alignment:
Q |
1 |
taaggaagaggatggatcgtctaaggagagtttgaattggtgtaggtagagaccttcttggtt |
63 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4194491 |
taaggaagaggatggatcgtctaaggagagtttgaattggtgtaggtagagaccttcttggtt |
4194429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 235
Target Start/End: Complemental strand, 4194301 - 4194266
Alignment:
Q |
200 |
catagtaaacaatggtattggtagtgattgatgatg |
235 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| |
|
|
T |
4194301 |
catagtaaacaatggtattggtagtgattgttgatg |
4194266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 34924927 - 34924977
Alignment:
Q |
13 |
tggatcgtctaaggagagtttgaattggtgtaggtagagaccttcttggtt |
63 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||| | |||||||||||| |
|
|
T |
34924927 |
tggatcgtctaaggtgagtttgaattggtagaggtataaaccttcttggtt |
34924977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University