View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_46 (Length: 256)
Name: NF0647_low_46
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0647_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 24 - 151
Target Start/End: Original strand, 27125457 - 27125584
Alignment:
Q |
24 |
cataggtatcttgctgagtttaagagtggcgctgagcgtaaagatgctgctgaaagtactcttactgcttataaatctgctcaggtcgatctttttctct |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27125457 |
cataggtatcttgctgagtttaagagtggcgctgagcgtaaagatgctgctgaaagtactcttactgcttataaatctgctcaggtcgatctttttctct |
27125556 |
T |
 |
Q |
124 |
gagatctaacgttatatttatggatctg |
151 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
27125557 |
gagatctaacgttatatttatggatctg |
27125584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 109
Target Start/End: Original strand, 45554301 - 45554383
Alignment:
Q |
27 |
aggtatcttgctgagtttaagagtggcgctgagcgtaaagatgctgctgaaagtactcttactgcttataaatctgctcaggt |
109 |
Q |
|
|
||||||||||||||||| |||| ||| || |||||||| || |||||||| || ||||| | ||||| |||||||||||||| |
|
|
T |
45554301 |
aggtatcttgctgagttcaagactggtgccgagcgtaaggaggctgctgagagcactctcgccgcttacaaatctgctcaggt |
45554383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University