View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0647_low_46 (Length: 256)

Name: NF0647_low_46
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0647_low_46
NF0647_low_46
[»] chr5 (1 HSPs)
chr5 (24-151)||(27125457-27125584)
[»] chr3 (1 HSPs)
chr3 (27-109)||(45554301-45554383)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 24 - 151
Target Start/End: Original strand, 27125457 - 27125584
Alignment:
24 cataggtatcttgctgagtttaagagtggcgctgagcgtaaagatgctgctgaaagtactcttactgcttataaatctgctcaggtcgatctttttctct 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27125457 cataggtatcttgctgagtttaagagtggcgctgagcgtaaagatgctgctgaaagtactcttactgcttataaatctgctcaggtcgatctttttctct 27125556  T
124 gagatctaacgttatatttatggatctg 151  Q
    ||||||||||||||||||||||||||||    
27125557 gagatctaacgttatatttatggatctg 27125584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 109
Target Start/End: Original strand, 45554301 - 45554383
Alignment:
27 aggtatcttgctgagtttaagagtggcgctgagcgtaaagatgctgctgaaagtactcttactgcttataaatctgctcaggt 109  Q
    ||||||||||||||||| |||| ||| || |||||||| || |||||||| || |||||  | ||||| ||||||||||||||    
45554301 aggtatcttgctgagttcaagactggtgccgagcgtaaggaggctgctgagagcactctcgccgcttacaaatctgctcaggt 45554383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University