View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_47 (Length: 251)
Name: NF0647_low_47
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 67 - 249
Target Start/End: Original strand, 38244485 - 38244667
Alignment:
| Q |
67 |
gatgatgaaaatgaatacttctactacttcttctcatcttgatcttgatgtaggtttatcatcacaactacaagaactgccttctcaaactatcaattta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38244485 |
gatgatgaaaatgaatacttctactacttcttctcatcttgatcttcatgtaggcttatcatcacaactacaagaactgccttctcaaactatcaattta |
38244584 |
T |
|
| Q |
167 |
tttgttactgatgttggggatattaacaagaatgataaaaggaagaagaagaagagcaatgaaaatatcgatgatggtaaaat |
249 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38244585 |
tttgttactgatgttagggatattaacaagaatgataaaaggaagaagaagaagagcaatgaaaatatcgatgatggtaaaat |
38244667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 93 - 243
Target Start/End: Original strand, 38260812 - 38260961
Alignment:
| Q |
93 |
cttcttctcatcttgatcttgatgtaggtttatcatcacaactacaagaactgccttctcaaactatcaatttatttgttactgatgttggggatattaa |
192 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||| || ||| | | ||| |||||||| ||||| |||| |
|
|
| T |
38260812 |
cttcttctcatcttgatctccatgtaggcttatcatcacaatcacaagaactgccttctcaaacaattaatatttcagttgctgatgtt-gggatgttaa |
38260910 |
T |
|
| Q |
193 |
caagaatgataaaaggaagaagaagaagagcaatgaaaatatcgatgatgg |
243 |
Q |
| |
|
|||||| |||| || |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
38260911 |
caagaacgatatgagaaagaagaagaagagaaatgaaaatattaatgatgg |
38260961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1241 times since January 2019
Visitors: 4114