View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_53 (Length: 247)
Name: NF0647_low_53
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0647_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 90 - 236
Target Start/End: Complemental strand, 46630978 - 46630832
Alignment:
| Q |
90 |
tagctgttgctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccatttgaaaaatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630978 |
tagctgttgctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccatttgaaaaatt |
46630879 |
T |
 |
| Q |
190 |
ctggtttgtgttacattttcccttctctttttctttgtccttcttcc |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46630878 |
ctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
46630832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 181
Target Start/End: Complemental strand, 15505201 - 15505121
Alignment:
| Q |
98 |
gctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccattt |
181 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||| ||||||||||| | |||||||| |||||||| ||||||||| |
|
|
| T |
15505201 |
gctgatgatcttctgaaactccatcttcttttctccttt---ggtgttgttgagattggagtagtaggattttcagttccattt |
15505121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 85
Target Start/End: Original strand, 39986920 - 39986994
Alignment:
| Q |
11 |
aatatcaacctgatccttccctcaactccaccaccaccttaacaacttctagcagctctagatcctcaagacaaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39986920 |
aatatcaacctgatccttccctcaactccaccaccaccttaacaacttctagcagctctagatcctcaagacaaa |
39986994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University