View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0647_low_60 (Length: 201)
Name: NF0647_low_60
Description: NF0647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0647_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 44542179 - 44542296
Alignment:
Q |
1 |
cttctcgaggttcatccttctcttcctctcccgaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44542179 |
cttctcgaggttcatccttctcttcctctcccgaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaa |
44542278 |
T |
 |
Q |
101 |
ggcaatttcctgatgatg |
118 |
Q |
|
|
||||||||| |||||||| |
|
|
T |
44542279 |
ggcaatttcttgatgatg |
44542296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University