View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0648_high_4 (Length: 376)

Name: NF0648_high_4
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0648_high_4
NF0648_high_4
[»] chr3 (1 HSPs)
chr3 (161-264)||(16060150-16060253)
[»] chr7 (1 HSPs)
chr7 (5-111)||(31772790-31772891)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 161 - 264
Target Start/End: Complemental strand, 16060253 - 16060150
Alignment:
161 ctcaaagacttcccccagtggcccttctggaacttgcccaggctgcgcagcctctggttgaggtgcgggctctcctccgggctgttccaagtccctaaag 260  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16060253 ctcaaagacttcccctagtggcccttctggaacttgcccatgctgcgcagcctctggttgaggtgcgggctctcctccgggctgttccaagtccctaaag 16060154  T
261 atag 264  Q
    ||||    
16060153 atag 16060150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 5 - 111
Target Start/End: Complemental strand, 31772891 - 31772790
Alignment:
5 ttcggttttcaacccagaaagggtctgggtccagctcggccatccgagatataatataacctgacttttgaggttaatcaaagttagaatatcatctatg 104  Q
    |||||||||||||| |||||||||| |||||||||||| ||||| |||||||||     ||||||||||||||||||||||||||| ||| |||||||||    
31772891 ttcggttttcaacctagaaagggtcggggtccagctcgcccatctgagatataa-----cctgacttttgaggttaatcaaagttataatttcatctatg 31772797  T
105 gggggct 111  Q
    |||||||    
31772796 gggggct 31772790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2960 times since January 2019
Visitors: 4020