View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_high_9 (Length: 311)
Name: NF0648_high_9
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0648_high_9 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 24 - 311
Target Start/End: Complemental strand, 5739419 - 5739122
Alignment:
Q |
24 |
tcatcatttagcaacgtatacaattgttaggtttgtcatttaacaactctttggttgagtttaaccgaaggtaaacaattgaggtcgcttatgatttagg |
123 |
Q |
|
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||| |
|
|
T |
5739419 |
tcattatttaacaacgtatacaattgttaggtttgtcatttaacaactctttggttgagtttaaccgaaggcaagcaattgaggtcgcttatgagttagg |
5739320 |
T |
 |
Q |
124 |
acagacaatccattaaaaactaactc----------aattgtttattgatgtaccaccttatatctctcactatttatctaatggaatgatttgaatttc |
213 |
Q |
|
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
5739319 |
acagacaacccattaaaaactaactctcaatctctcaattgtttattgatgtaccaccttatatctctcactatttatctaatggaatgatttgagtttc |
5739220 |
T |
 |
Q |
214 |
ttcccctaaaaaagaattgtcatgtaatctatcaaatacttggtcactcaattggtttcaaagtataaaatagagtgatagtacaaagataaccggat |
311 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5739219 |
ttcccctaaaaaagaattgtcatgtaatctatcaaatacttggtcactcaattggtttcaaagtataaaatagagtgatagtacaaagataaccggat |
5739122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3256 times since January 2019
Visitors: 4030