View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_19 (Length: 376)
Name: NF0648_low_19
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 161 - 264
Target Start/End: Complemental strand, 16060253 - 16060150
Alignment:
| Q |
161 |
ctcaaagacttcccccagtggcccttctggaacttgcccaggctgcgcagcctctggttgaggtgcgggctctcctccgggctgttccaagtccctaaag |
260 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16060253 |
ctcaaagacttcccctagtggcccttctggaacttgcccatgctgcgcagcctctggttgaggtgcgggctctcctccgggctgttccaagtccctaaag |
16060154 |
T |
 |
| Q |
261 |
atag |
264 |
Q |
| |
|
|||| |
|
|
| T |
16060153 |
atag |
16060150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 5 - 111
Target Start/End: Complemental strand, 31772891 - 31772790
Alignment:
| Q |
5 |
ttcggttttcaacccagaaagggtctgggtccagctcggccatccgagatataatataacctgacttttgaggttaatcaaagttagaatatcatctatg |
104 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
31772891 |
ttcggttttcaacctagaaagggtcggggtccagctcgcccatctgagatataa-----cctgacttttgaggttaatcaaagttataatttcatctatg |
31772797 |
T |
 |
| Q |
105 |
gggggct |
111 |
Q |
| |
|
||||||| |
|
|
| T |
31772796 |
gggggct |
31772790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University