View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_27 (Length: 322)
Name: NF0648_low_27
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 87 - 317
Target Start/End: Original strand, 16013794 - 16014024
Alignment:
| Q |
87 |
ccctacacaacatatccgtaaaatcagtgcagccagatccacgctagtcggagactatccgtaaaatccatacatccatgacagaaaatatggctttgaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16013794 |
ccctacacaacatatccgtaaaatcagtgcagccagatccacgctagtcggagactatccgtaaaatccatacatccatgacagaaaatatggctttgaa |
16013893 |
T |
|
| Q |
187 |
gtgaaaaaataaaattgtacaactctttacaattaaacaaggtttctactaatataggatacatgtagcaaataactaaacaagataaataaattcagga |
286 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16013894 |
gtgaaaaaataaaatcgtacaactctttacaattaaacaaggtttctactaatataggatacatgtagcaaataactaaacaagataaataaattcagga |
16013993 |
T |
|
| Q |
287 |
tcctagatatcacctgttcatctgtgctcct |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
16013994 |
tcctagatatcacctgttcatctgtgttcct |
16014024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 16013747 - 16013796
Alignment:
| Q |
19 |
ggacatcatcccttgtctttgatagaccaaaataaaaacaattgtcttccc |
69 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16013747 |
ggacatcatcccttgtctt-gatagaccaaaataaaaacaattgtcttccc |
16013796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3204 times since January 2019
Visitors: 4030