View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_36 (Length: 296)
Name: NF0648_low_36
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 56 - 228
Target Start/End: Original strand, 5932662 - 5932833
Alignment:
| Q |
56 |
aagggaaattagggcttcaacccgattgaaggtagaaattgtcgtagggtcgtatactcctaagaggttggagatggatcccatcatatatacgacacga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5932662 |
aagggaaattagggcttcaacccgattgaaggtagaaattgtcgtagggtcgtatactcctaagaggttggagatggatcccatcatatatacgacacga |
5932761 |
T |
|
| Q |
156 |
cttttgaacgggttttccactgagggggtatttggtgaataaataggtattttgatttctggtttgttttgtg |
228 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5932762 |
ctgttgaacgggttttccactgagggggtatttggtgaataaataggtattttg-tttctggtttgttttgtg |
5932833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3407 times since January 2019
Visitors: 4035