View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_39 (Length: 289)
Name: NF0648_low_39
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0648_low_39 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 64 - 289
Target Start/End: Original strand, 41766624 - 41766849
Alignment:
Q |
64 |
tcatcattggattaggagaaggatggatcattgacacagaagatgacggaaatggttggttgaatggaccacttgggggtcgacttgataaccaaagctt |
163 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41766624 |
tcatcattggattaggagaaggatggatcattgacacagaagatgacggaaatggttggttgaatggaccacttgggggtcgacttgataaccaaagctt |
41766723 |
T |
 |
Q |
164 |
aaaacggtaataagcattgccctccccaccaaagagaaaactataagaaggattatcccgttgcttttcacaaatcatggcttcaaattcagggccattt |
263 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41766724 |
aaaacggtaataagcattgccctccccaccaaagagaaaactataagaaggattatcccgttgcttttcacaaatcatggcttcaaattcagggccattt |
41766823 |
T |
 |
Q |
264 |
ttcaccgcatactcaacaagtttgtc |
289 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
41766824 |
ttcaccgcatactcaacaagtttgtc |
41766849 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University