View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_5 (Length: 449)
Name: NF0648_low_5
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 154 - 441
Target Start/End: Complemental strand, 12997990 - 12997704
Alignment:
| Q |
154 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12997990 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
12997891 |
T |
 |
| Q |
254 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctatctttcaattttatttgttattaggaagcacgtatact |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
12997890 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctgtctttcaattttatttgttattaggaaacacatatact |
12997791 |
T |
 |
| Q |
354 |
ttttggattatgcgtgtctctattagattatgtttggcgtccgacacatatgattgcatatattttttggattatgcgtgtctctgct |
441 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
12997790 |
ttttggattatgcgtgtctctgttaga-tatgtttggcgtccgacacatatcattacatatactttttggattatgcgtgtctctgct |
12997704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 154 - 441
Target Start/End: Complemental strand, 13072630 - 13072344
Alignment:
| Q |
154 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13072630 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
13072531 |
T |
 |
| Q |
254 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctatctttcaattttatttgttattaggaagcacgtatact |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
13072530 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctgtctttcaattttatttgttattaggaaacacatatact |
13072431 |
T |
 |
| Q |
354 |
ttttggattatgcgtgtctctattagattatgtttggcgtccgacacatatgattgcatatattttttggattatgcgtgtctctgct |
441 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
13072430 |
ttttggattatgcgtgtctctgttaga-tatgtttggcgtccgacacatatcattacatatactttttggattatgcgtgtctctgct |
13072344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 12997869 - 12997802
Alignment:
| Q |
1 |
acatactttggacaatatttgatgcgatgcttctatctctagctgtcaagtttatttgttattaggaa |
68 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
12997869 |
acatactttggacaatatttgattcgatgcttctatctctgtctttcaattttatttgttattaggaa |
12997802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 13072509 - 13072442
Alignment:
| Q |
1 |
acatactttggacaatatttgatgcgatgcttctatctctagctgtcaagtttatttgttattaggaa |
68 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
13072509 |
acatactttggacaatatttgattcgatgcttctatctctgtctttcaattttatttgttattaggaa |
13072442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 168 - 275
Target Start/End: Complemental strand, 28139138 - 28139031
Alignment:
| Q |
168 |
ggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatgaactttggtggggaa |
267 |
Q |
| |
|
|||||| |||| |||||||| || |||||||| || || | ||| ||||| |||||||| || |||||| | | ||||| ||||| ||||||||||||| |
|
|
| T |
28139138 |
ggagcattggctacactttcgggggccaagaccggacggtgtccaagagataagcgtgtcgtcaaggatgatctcactgagaatgagctttggtggggaa |
28139039 |
T |
 |
| Q |
268 |
agtaagta |
275 |
Q |
| |
|
|||||||| |
|
|
| T |
28139038 |
agtaagta |
28139031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University