View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_52 (Length: 257)
Name: NF0648_low_52
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0648_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 42224690 - 42224485
Alignment:
Q |
16 |
attattcttatacgaggacaataaatgttgaagttatgaaaaaattaaggaagcgctaaatattttatcatatttaagannnnnnnnattgatttgtgcc |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
42224690 |
attattcttatacgaggacaataaatgttgaagttatgaaaaaattaaggaagcactaaatattttatcatatttaagattttttttattgatttgtgcc |
42224591 |
T |
 |
Q |
116 |
tgtaatgccatgttggggcaagaattttctctcnnnnnnnnnctaggttaaagaagaatatggctcttgtatgctttgtgtacatttcccttgtttaatt |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42224590 |
tgtaatgccatgttggggcaagaattttctctc-ttttttttctaggttaaagaagaatatggctcttgtatgctttgtgtacatttcccttgtttaatt |
42224492 |
T |
 |
Q |
216 |
gaataat |
222 |
Q |
|
|
||||||| |
|
|
T |
42224491 |
gaataat |
42224485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3366 times since January 2019
Visitors: 4034