View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_63 (Length: 250)
Name: NF0648_low_63
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 43698254 - 43698474
Alignment:
| Q |
11 |
cagagactagtaaaccaaaatagcatgaagctatgattgaggatcagagatacaaaccgataaataaggttatcattcaatccagctccgctgccaatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
43698254 |
cagagactagtaaaccaaaatagcatgaagctatgattgaggatcagagatacaaaccgataaataaggttatcattcaatccagctccactgccgatga |
43698353 |
T |
|
| Q |
111 |
aggctctggaaatctcttcgtttactgtatttctctgtgtgatagaaattgcccacgcccttcctggagttaaaatatcacatacagttgtagatgaaat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43698354 |
aggctctggaaatctcttcatttactgtatttctctgtgtgatagaaattgcccacgcccttcctggagttaaaatatcacatacagttgtagatgaaat |
43698453 |
T |
|
| Q |
211 |
ttctccaacagaggaggaatc |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43698454 |
ttctccaacagaggaggaatc |
43698474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3226 times since January 2019
Visitors: 4030