View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_7 (Length: 443)
Name: NF0648_low_7
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 88 - 433
Target Start/End: Complemental strand, 48070451 - 48070106
Alignment:
| Q |
88 |
catcatcaaaatcaaaatcacctttgggtttattataaggactactataacccattgggctatcagtttcaacagaagcccttgtaatagttggacttct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070451 |
catcatcaaaatcaaaatcacctttgggtttattataaggactactataacccattgggctatcagtttcaacagaagcccttgtaatagttggacttct |
48070352 |
T |
 |
| Q |
188 |
attctcaaacatgatttttgcatccaaaggtccagatattggactcttggtgaatcttccatcaatagccctacttcttaatggacttctattagtataa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070351 |
attctcaaacatgatttttgcatccaaaggtccagatattggactcttggtgaatcttccatcaatagccctacttcttaatggacttctattagtataa |
48070252 |
T |
 |
| Q |
288 |
atcatcattctctcattcatcaatcttccatcaattggtcctgataacttcaatgccttattattgctgaccattttctgctcatgcattcttccatcta |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48070251 |
atcatcattctctcattcatcaatcttccatcaattggtcctgataacttcaatgccttattattgctcaccattttctgctcatgcattcttccatcta |
48070152 |
T |
 |
| Q |
388 |
atggtcctgaatatggcattgttctgcttctatatataggtctctg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070151 |
atggtcctgaatatggcattgttctgcttctatatataggtctctg |
48070106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University