View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0648_low_77 (Length: 217)
Name: NF0648_low_77
Description: NF0648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0648_low_77 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 30 - 136
Target Start/End: Complemental strand, 23225436 - 23225330
Alignment:
| Q |
30 |
aatcattgtcctggtgttaaatttagatagcgaactttgtctttaattatctctcaattgtatctgctttgctgaattaattcatttgcttaatttaatt |
129 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23225436 |
aatcattgtcctggtgttaattttagatagcgaactttgtctttaattatctctcaattgtatctgctttgctgaattaattcatttgcttaatttaatt |
23225337 |
T |
|
| Q |
130 |
tgtcgat |
136 |
Q |
| |
|
||||||| |
|
|
| T |
23225336 |
tgtcgat |
23225330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 82
Target Start/End: Complemental strand, 23217706 - 23217675
Alignment:
| Q |
51 |
tttagatagcgaactttgtctttaattatctc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23217706 |
tttagatagcgaactttgtctttaattatctc |
23217675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3524 times since January 2019
Visitors: 4036