View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0649_high_8 (Length: 248)
Name: NF0649_high_8
Description: NF0649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0649_high_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 423055 - 423302
Alignment:
| Q |
1 |
acatttgcaagaaaggaacccaatttgtcttccctttctttcttcttaatcttcttccccttgatgtcatatccaatatggggttcatcctcataccact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423055 |
acatttgcaagaaaggaacccaatttgtcttccctttctttcttcttaatcttcttccccttgatgtcatatccaatatggggttcatcctcataccact |
423154 |
T |
 |
| Q |
101 |
tcaaagggacctctccaatggtattccgaggagccacctacggaaaaaggaaacgcagagcaatcaaattcaagtccatagtaatataaaagggaattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
423155 |
tcaaagggacctctccaatggtattccgaggagccacctacggaaaaaggaaacgcagagcaatcaaattcaagtccatagtaatataaatgggaattga |
423254 |
T |
 |
| Q |
201 |
ttacaacaaataattataatgatgatgatggatacctcatcctcagat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423255 |
ttacaacaaataattataatgatgatgatggatacctcatcctcagat |
423302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University