View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0649_high_9 (Length: 229)
Name: NF0649_high_9
Description: NF0649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0649_high_9 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 40 - 229
Target Start/End: Original strand, 32313618 - 32313807
Alignment:
Q |
40 |
atggacatcatcaaacactagtacatttgattttagttttactacaagatagactcactttcctgccaggacttgctttcagaaaacttagtgtgccatc |
139 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32313618 |
atggacatcaccaaacactagtacatttgattttagttttactacaagattgactcactttcctgccaggacttgctttcagaaaacttagtgtgccatc |
32313717 |
T |
 |
Q |
140 |
attttcaatttcaaaatttcaccatattgtaaaaattgaataaaaaacgatcagaactatcgttttcagttattaggtactatgatttcc |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
32313718 |
attttcaatttcaaaatttcaccatattgtaaaaattgaataaaaaacgatcagaactatcgttttcagttattaagtactatgatttcc |
32313807 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University