View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0649_low_22 (Length: 244)
Name: NF0649_low_22
Description: NF0649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0649_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 43259109 - 43259214
Alignment:
| Q |
1 |
gtccaccagggtatgctggttcgccggaacctccaagccctttctcaagtcctaagaagtattgtttacccatggagccaggattgtaccaatcttggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43259109 |
gtccaccagggtatgctggttcgccggaacctccaagccctttctcaagtcctaagaagtattgttttcccatggagccaggattgtaccaatcttggaa |
43259208 |
T |
|
| Q |
101 |
tcttct |
106 |
Q |
| |
|
|||||| |
|
|
| T |
43259209 |
tcttct |
43259214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 43255843 - 43255948
Alignment:
| Q |
1 |
gtccaccagggtatgctggttcgccggaacctccaagccctttctcaagtcctaagaagtattgtttacccatggagccaggattgtaccaatcttggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
43255843 |
gtccaccagggtatgctggttcgccggaacctccaagccctttctcaagtcctaagaagtattgttttcccatggaaccaggattgtaccaatcttggag |
43255942 |
T |
|
| Q |
101 |
tcttct |
106 |
Q |
| |
|
|||||| |
|
|
| T |
43255943 |
tcttct |
43255948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 43247846 - 43247918
Alignment:
| Q |
1 |
gtccaccagggtatgctggttcgccggaacctccaagccctttctcaagtcctaagaagtattgtttacccat |
73 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
43247846 |
gtccaccagggtatgctggttcaccggaaccgccaagacctttctcaagtcctaaaaagtattgttttcccat |
43247918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3370 times since January 2019
Visitors: 4034