View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0649_low_27 (Length: 229)
Name: NF0649_low_27
Description: NF0649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0649_low_27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 40 - 229
Target Start/End: Original strand, 32313618 - 32313807
Alignment:
| Q |
40 |
atggacatcatcaaacactagtacatttgattttagttttactacaagatagactcactttcctgccaggacttgctttcagaaaacttagtgtgccatc |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32313618 |
atggacatcaccaaacactagtacatttgattttagttttactacaagattgactcactttcctgccaggacttgctttcagaaaacttagtgtgccatc |
32313717 |
T |
|
| Q |
140 |
attttcaatttcaaaatttcaccatattgtaaaaattgaataaaaaacgatcagaactatcgttttcagttattaggtactatgatttcc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32313718 |
attttcaatttcaaaatttcaccatattgtaaaaattgaataaaaaacgatcagaactatcgttttcagttattaagtactatgatttcc |
32313807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3342 times since January 2019
Visitors: 4032