View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0650_low_3 (Length: 376)

Name: NF0650_low_3
Description: NF0650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0650_low_3
NF0650_low_3
[»] chr1 (1 HSPs)
chr1 (1-109)||(52926083-52926191)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 52926083 - 52926191
Alignment:
1 tcatcagcatttactctggtgattgcggagcggtgagcacggtcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52926083 tcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtg 52926182  T
101 gaacgggag 109  Q
    |||||||||    
52926183 gaacgggag 52926191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University