View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0650_low_3 (Length: 376)
Name: NF0650_low_3
Description: NF0650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0650_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 52926083 - 52926191
Alignment:
| Q |
1 |
tcatcagcatttactctggtgattgcggagcggtgagcacggtcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926083 |
tcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtg |
52926182 |
T |
 |
| Q |
101 |
gaacgggag |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
52926183 |
gaacgggag |
52926191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University