View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0651_low_16 (Length: 210)
Name: NF0651_low_16
Description: NF0651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0651_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 47299358 - 47299432
Alignment:
| Q |
1 |
tagagaagcagtatctttttccttaatggtatttggcgaaagaatttgttcgtattcaaaatggttgcatgtaat |
75 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47299358 |
tagagaagcagtatctttttccttaattgtatttggcgaaagaatttgttcgtattcaaaatggttgcatgtaat |
47299432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 47292751 - 47292825
Alignment:
| Q |
1 |
tagagaagcagtatctttttccttaatggtatttggcgaaagaatttgttcgtattcaaaatggttgcatgtaat |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
47292751 |
tagagaagcagtatcttcttccttaatggtatttggcgaaaaaatttgtttgtattcaagatggttgcatgtaat |
47292825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 47267487 - 47267423
Alignment:
| Q |
11 |
gtatctttttccttaatggtatttggcgaaagaatttgttcgtattcaaaatggttgcatgtaat |
75 |
Q |
| |
|
||||||| |||||| || ||||||| ||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
47267487 |
gtatcttcttccttgattgtatttgacgaaaaaatttgttcgtattcatgatggttgcatgtaat |
47267423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 47242559 - 47242512
Alignment:
| Q |
28 |
ggtatttggcgaaagaatttgttcgtattcaaaatggttgcatgtaat |
75 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
47242559 |
ggtatttggcgaaagtatttgttcgtattcacgatggttgcatgtaat |
47242512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 32731230 - 32731183
Alignment:
| Q |
28 |
ggtatttggcgaaagaatttgttcgtattcaaaatggttgcatgtaat |
75 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
32731230 |
ggtatttggcgaaagtatttgttcgtattcacgatggttgcatgtaat |
32731183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3329 times since January 2019
Visitors: 4032